0 answers

Fama-Macbeth regressions in MATLAB

I have a data set of 25 stock returns (ER1, ER2... ER25) for a period of 570 months and I want to run Fama-MacBeth regressions (to test CAPM) on it i.e. 570 second pass regressions. Here's an ...

0 answers

Error calling GUI in MATLAB

Completely new to using the GUIDE feature to create GUI in MATLAB. Purpose: Call GUI within a function. The code looks something like this. The name of the GUI is selectBitrate. function output = ...

1 answer

Matlab Video of logical images

I have a video where I apply chroma key to each frame to extract color. newImage = (checkR)&(checkG)&(checkB);% for each frame In the end I put all frames in similar video container ...

1 answers | 21 mins ago by Tony on Stack Overflow stackoverflow.com
1 answer

How to pass a Matlab vector variable to a MuPAD function?

I want to use the stats::swGOFT function in MuPAD. I have a numerical vector called r. I used feval(symengine, 'stats::swGOFT', r); The error was Error using mupadengine/feval (line 157) ...

1 answer

Image rectification using rectifyStereoImages in MATLAB

i want to rectify two stereo image captured by two cameras. I want to do the rectification using the MATLAB function rectifyStereoImages: rectifystereoimages My Problem is that the stereoParams ...

1 answers | 1 hour ago by Hallohal392 on Stack Overflow stackoverflow.com
0 answers

MATLAB Yahoo data feed error

I'm trying to use Yahoo API in MATLAB R2015a to retrieve historical data (prices) for commodities. I can get the price for current date, but not for a historical date range. So for example Last price ...

2 answers

Create inverse logical array in Matlab

I have a logical array, isLand, that is true if the index is over land and false if the index is not over land, like the ocean. How can I easily create another logical array, isOcean, which is the ...

2 answers | 1 hour ago by Elpezmuerto on Stack Overflow stackoverflow.com
0 answers

Creating a matching game

What I'm trying to do is get the push button I press and the image of above it to set their visible property to off when I press the push-button so i can replace the image with a different picture ...

2 answers

Logical vs Numerical array in MATLAB

I am comparing two binary arrays. I have an array where values can either be one or zero, one if the values are the same and zero if they are not. Please note I am doing other stuff beyond checking, ...

1 answer

How to form a projection matrix in OpenCV and Matlab calibration tool box?

The projection matrix in camera calibration is a 3x4 matrix P = camera matrix * [R|t] However in the OpenCV Documentation, it didn't mention if the R and t are formed by the rvec and tvec, the ...

3 answers

sparse matrix values as indexes to another matrix

S - NxN sparse matrix. A - Mx1 vector. The non zero values of S are the indexes of A. I want to calculate a vector x such that in the i'th entry of x: for each non zero value j in the i'th row of S , ...

0 answers

Problems using arduino to xbee and arduino to matlab

I have coordinate values (longitude and latitude), and I am sending these coordinates form arduino-1 to arduino-2 using Xbee module. I have received these coordinates at arduino-2 correctly but I ...

0 answers

How to use function return values as matrix rows?

I was trying to plot function return values, one based on another. My function definition is: function [final_speed, voltage] = find_final_speed(simulink_output) As you can see, it returns two ...

1 answer

Error in loop: Attempted to access L(1); index out of bounds because numel(L)=0

I tried searching, but don't seem to see any solutions for my problem. It says Attempted to access L(1); index out of bounds because numel(L)=0. Error in Energy_Management_code (line 64) ...

1 answers | 3 hours ago by Aisyah Burhanudin on Stack Overflow stackoverflow.com
2 answers

what does Tilde image mean in MATLAB?

I am working on a code for image processing in Matlab and the thinning won't work unless I call the function on the original image with the tilde and then save it to the same variable (found it ...

2 answers | 3 hours ago by Anna on Stack Overflow stackoverflow.com
0 answers

Difficulties building vector of functions for fsolve

I am trying to implement a program using fsolve in matlab. I want the program to be able to compare n elements pairwise and where each comparison is a row in a function vector F of which fsolve is ...

1 answer

Matlab - Scaling and labelling axes

I have an mxn matrix in matlab, and I'm trying to use the image function on it. When I do, it automagically makes the axes 0:m, and 0:n. The image corresponds to a map of intensity in a two ...

1 answers | 3 hours ago by Alex on Stack Overflow stackoverflow.com
0 answers

conveting each cell of a cell matrix into a txt file

suppose I have a cell like this: A=[b0002, acgttggaaaccggggttaacgg] I want to put the acgttggaaaccggggttaacgg string in a temporary variable that ends with .fas . and pass it to the other function. ...

1 answer

Save a matrix the way it is displayed in the command window

I would like to store data in a text file formatted exactly the way it is displayed in the command Window. For example, >> A = 20*randn(4,4) A = -1.0984 25.0050 -13.0311 -38.9769 ...

1 answers | 3 hours ago by CroCo on Stack Overflow stackoverflow.com
0 answers

Problems with using mxarrays with the step function in MATLAB Coder

I'm trying to convert my image processing code on MATLAB into C by using MATLAB coder. using 'imread' needs a coder.entrinsic declaration. However, this means that the output to imread will be an ...

2 answers

Converting a price as a string to useable number in Matlab

I'm trying to convert a price value obtained from a URL as a string into a number. The returned string gives the price with the dollar sign. function [ price ] = price( url ) %UNTITLED4 Summary of ...

2 answers | 3 hours ago by Carpenterguy on Stack Overflow stackoverflow.com
1 answer

How to ensure that a vector of date numbers is fully contained in another in MATLAB

I have two vectors A and B containing date numbers. In theory, all coefficients in B should also be contained in A. Unfortunately this is not the case. My theory justifies replacing all ...

1 answers | 4 hours ago by Constantin on Stack Overflow stackoverflow.com
0 answers

how to call function handle correctly from different m file?

This is the first m file function [y]=f_x(x) y = sin (x).*exp (-x/2);% function of f(x) end the second m file function [z]=f_x_y(X,Y) z=sin(3*(X.^2+Y.^2)).*exp(-0.5*(X.^2+Y.^2)); % ...

0 answers

Constructor cannot access private properties of its own class??

I'm trying to write a class that create integral object. However, the constructor is not working properly. It cannot set the integral.value to correct value when GetAccess is set to private or ...

1 answer

MATLAB: adding element of vector until reach to a particular number

I get stuck in one question in my textbook. The question is to determine The number of random numbers it takes to add up to 20 (or more). I use loop for this situation. But I am not not at it. and I ...

1 answers | 5 hours ago by Tim Nguyen on Stack Overflow stackoverflow.com
0 answers

Datcomimport Matlab Error

I'm trying to use the matlab function datcomimport to import my datcom output file. When trying to import I get the following error: Assignment has fewer non-singleton rhs dimensions than ...

1 answer

Merge rows with connecting dates

I've got a large Excel sheet with customer and subscription data. From this table I would like to merge records/rows with connection stop_ and start_dates and show the result in a new worksheet. A ...

0 answers

how to pass splited wav file in matlab?

Here is my code for audio file splitting and then do feature extraction on it Filename=uigetfile('*.wav','Select the MATLAB code file'); disp(Filename) [y, fs]=wavread(Filename); ...

0 answers

MatLab Coder: MatLab to C - Output argument not assigned on some execution paths

I am trying to run MatLab Coder to transform a matlab .m file into .mex to hopefully run the code more quickly. When trying to build the file via MatLab Coder engine, I get the following error: ...

1 answer

MatLab Coder - MatLab to C

I am trying to run MatLab Coder to transform a matlab .m file into .mex to hopefully run the code more quickly. When trying to build the file via MatLab Coder engine, I get the following error: ...

15 30 50 per page
1 2 3